Assaying sperm crossover hotspots near minisatellite MS32

Seven meiotic recombination hotspots have been defined in a 208 kb region around minisatellite MS32 and its associated hotspot.  There are two pairs of closely spaced hotspots which can be assayed in a single test interval, and thus five separate assays for sperm crossovers have been developed.  Each hotspot or hotspot pair is assayed in sperm DNA by PCR amplifying aliquots of DNA with two allele-specific primers in repulsion phase directed to SNP sites that are heterozygous in the semen donor to selectively amplify recombinant molecules.  PCR products from this 1° PCR are then digested with S1 nuclease and reamplified using repulsion phase allele-specific primers directed to two internal heterozygous SNP sites to increase the specificity of single molecule recombinant recovery.  2° PCR reactions showing a recombinant are then re-amplified using two internal universal primers.  In some cases, one of these universal primers is replaced by an allele-specific primer to improve the specificity of crossover recovery in the 3° PCRs.  Crossover breakpoints in 3° PCR products are then mapped by dotblot hybridisation with ASOs.

Details of selector SNP sites and their locations relative to the centre of minisatellite MS32, plus allele-primers (ASPs) and universal primers together with PCR cycling conditions for each hotspot region are given below. Some allele-specific primers include a synthetic 5' extension indicated in blue lower case; these extension were added to improve PCR efficiency.

 

 

To download a pdf version of this page, click here.

 

Hotspot NID3

 

 

1° PCR:

SNPs:

    M-128.3C/A (-128,265 bp) and M-120.3A/C (-120,276 bp)

 

ASPs:

                    M-128.3FC   5' CTGGAGTCACGGGGGC 3'

                 or M-128.3FA   5' CTGGAGTCACGGGGGA 3'

together with       M-120.3RA   5' TCTTTAGCCCCACTGCTT 3'

                 or M-120.3RC   5' TCTTTAGCCCCACTGCTG 3'

 

PCR cycling:

1 cycle of 96° 1.5 min

6 cycles of 96° 20 sec, 65° 8.5 min

18 cycles of 96° 20 sec, 64° 8.5 min

 

 

2° PCR:

SNPs:

    M-127.9A/C (-127,915 bp) and M-120.6T/G (-120,648 bp)

 

ASPs:

                    M-127.9FA   5' GGCCATTTTGGAAAATACCATA 3'

                 or M-127.9FC   5' GCCATTTTGGAAAATACCATC 3'

together with       M-120.6RT   5' ggggTATCAACTGCTTCCCAGA 3'

                 or M-120.6RG   5' ggggTATCAACTGCTTCCCAGC 3'

 

 

PCR cycling:

1 cycle of 96° 1 min

5 cycles of 96° 20 sec, 66° 8.5 min

6 cycles of 96° 20 sec, 65° 8.5 min

21 cycles of 96° 20 sec, 64° 8.5 min

 

 

3° PCR:

Primers:

                    M-127.1F    5' ACACCACCTATGTAATTGGC 3'

together with       M-120.8R    5' GCCCAAGAGGAAGTGGTAGG 3'

 

 

PCR cycling:

1 cycle of 96° 1 min

4 cycles of 96° 20 sec, 64° 8 min

5 cycles of 96° 20 sec, 62° 30 sec, 64° 8 min

6 cycles of 96° 20 sec, 60° 30 sec, 64° 8 min

15 cycles of 96° 20 sec, 58° 30 sec, 64° 8 min

 

 

Hotspots NID2a,2b

 

 

1° PCR:

SNPs:

    M-103.3T/G (-103,265 bp) and M-94.5C/T (-94,486 bp)

 

ASPs:

                    M-103.3FT   5' CTCAGAACCACGAGGGCT 3

                 or M-103.3FG   5' CTCAGAACCACGAGGGCG 3

together with       M-94.5RC2   5' AATCCGCGGAGTGATCG 3'

                 or M-94.5RT2   5' AATCCGCGGAGTGATCA 3'

 

PCR cycling:

Using M-103.3FT plus M-94.5RC2:

1 cycle of 96° 1.5 min

5 cycles of 96° 20 sec, 66° 10.5 min

20 cycles of 96° 20 sec, 65° 30 sec, 66° 10 min

 

Using M-103.3FG plus M-94.5RT2:

1 cycle of 96° 1.5 min

5 cycles of 96° 20 sec, 62° 30 sec, 66° 10 min

5 cycles of 96° 20 sec, 61° 30 sec, 66° 10 min

15 cycles of 96° 20 sec, 60° 30 sec, 66° 10 min

 

 

2° PCR:

SNPs:

    M-100.4C/T (-100,401 bp) and M-95.3A/T (-95,326 bp)

 

ASPs:

                    M-100.4FC   5' CTGTCTCAGACTCCTGTGC 3'

                 or M-100.4FT   5' CTGTCTCAGACTCCTGTGT 3'

together with       M-95.3RA    5' ccccGTGATTTTAAAAGCCCTGCT 3'

                 or M-95.3RT    5' ccccGTGATTTTAAAAGCCCTGCA 3'

 

PCR cycling:

1 cycle of 96° 1 min

4 cycles of 96° 20 sec, 65° 30 sec, 66° 7 min

5 cycles of 96° 20 sec, 64° 30 sec, 66° 7 min

6 cycles of 96° 20 sec, 63° 30 sec, 66° 7 min

18 cycles of 96° 20 sec, 62° 30 sec, 66° 7 min

 

 

3° PCR:

Primers:

                    M-100.0F    5' GAATAGGTCTAGGGTAGGG 3'

together with        M-95.7R    5' GAGGATGAAGACCATGTCAG 3'

 

 

PCR cycling:

1 cycle of 96° 1 min

24 cycles of 96° 20 sec, 61° 30 sec, 66° 6 min

 

 

Hotspot NID1

 

1° PCR:

SNPs:

    M-61.6T/C (-61,556 bp) and M-55.4T/C (-55,421 bp)

 

ASPs:

                    M-61.6FT    5' CTAGGCAGGGGCTGCCAT 3'

                 or M-61.6FC    5' CTAGGCAGGGGCTGCCAC 3'

together with       M-55.4RT    5' cccAGATGTCAGTTGTGAGCA 3'

                 or M-55.4RC    5' cccAGATGTCAGTTGTGAGCG 3'

 

PCR cycling:

1 cycle of 96° 1.5 min

6 cycles of 96° 20 sec, 64° 6.5 min

18 cycles of 96° 20 sec, 63° 6.5 min

 

 

2° PCR:

SNPs:

    M-61.5G/T (-61,523 bp) and M-55.5C/T (-55,481 bp)

 

ASPs:

                    M-61.5FG    5' ccccCGTTCTGATGACTTTTCG 3'

                 or M-61.5FT    5' ccccCGTTCTGATGACTTTTCT 3'

together with       M-54.5RA    5' ccccAAGACACTCTTATCACTT 3'

                 or M-54.5RG    5' ccccAAGACACTCTTATCACTC 3'

 

PCR cycling:

1 cycle of 96° 1 min

6 cycles of 96° 20 sec, 64° 6.5 min

23 cycles of 96° 20 sec, 62° 30 sec, 63° 6.5 min

 

 

3° PCR:

Primers:

                     M-60.8F    5' CTATGGCAGGTAGGGGTTCTG 3'

together with        M-55.5R    5' GCCCAGTGGCTTCAGAGATGCTC 3'

 

PCR cycling:

1 cycle of 96° 1 min

5 cycles of 96° 20 sec, 64° 6.5 min

5 cycles of 96° 20 sec, 62° 30 sec, 63° 6.5 min

16 cycles of 96° 20 sec, 60° 30 sec, 63° 6.5 min

 

 

Hotspot MSTM1a,1b

 

Different combinations of allele-specific primers need to be used on different individuals depending on available heterozygous SNP sites and linkage phase.

 

1° PCR:

SNPs:

    M+19.5G/T (19,549 bp) OR M+20.7G/A (20,758 bp)

    OR M+20.8T/C (20,768 bp) AND M+30.5G/A (30,490 bp)

    OR M+30.2C/T (30,164 bp)

 

ASPs:

                    M+19.5RG    5' TGTGGGGTTACCAGGAATG 3'

                 or M+19.5RT    5' TGTGGGGTTACCAGGAATT 3'

                 or M+20.7RG    5' TCCCAAGCTTTCAGCACG 3'

 

                 or M+20.7RA    5' CTCCCAAGCTTTCAGCACA 3'

                 or M+20.8RT    5' TTCAGCACGAGCTCTCCTT 3'

 

                 or M+20.8RC    5' TTCAGCACAAGCTCTCCTC 3'

together with       M+30.5FG    5' TGTGTGAGCTGCGAGGAC 3'

                 or M+30.5FA2   5' GTGTGAGCTGCGAGGAT 3'

                 or M+30.2FC2   5' GAGCCACAGGGCAACG 3'

                 or M+30.2FT2   5' GAGCCACAGGGCAACA 3'

 

PCR cycling:

1 cycle of 96° 1.5 min

5 cycles of 96° 20 sec, 66° 14 min

7 cycles of 96° 20 sec, 65° 14 min

13 cycles of 96° 20 sec, 64° 14 min

 

NB. if using M+19.5RT then cycle:

1 cycle of 96° 1.5 min

6 cycles of 96° 20 sec, 61° 30 sec, 64° 14 min

8 cycles of 96° 20 sec, 60° 30 sec, 64° 14 min

11 cycles of 96° 20 sec, 59° 30 sec, 64° 14 min

 

 

2° PCR:

SNPs:

M+19.9C/A & M+19.9aG/A (19,957-9 bp) OR M+20.1C/T (20,061 bp)

OR M+20.7G/A (20,758 bp) OR M+20.8T/C (20,768 bp)

OR M+20.9T/C (20,913 bp) AND M+29.1T/C (29,055 bp)

OR M+30.1G/C (30,109 bp) OR M+30.2C/T (30,164 bp)

 

NB. good allele-specific primers cannot be designed for

some alleles at these SNPs.

 

ASPs:

                    M+19.9/aRCG 5' CAGGACCCTGTCTCCAG 3'

                 or M+20.1RT    5' GTGCAGTGGCACCATCTT 3'

                 or M+20.7RG    5' TCCCAAGCTTTCAGCACG 3'

                 or M+20.7RA    5' CTCCCAAGCTTTCAGCACA 3'

                 or M+20.8RT    5' TTCAGCACGAGCTCTCCTT 3'

                 or M+20.8RC    5' TTCAGCACAAGCTCTCCTC 3'

                 or M+20.9RC    5' GTGTACAATTCAGTGGGGC 3'

together with       M+29.1FT    5' AGCCAAGATTGAGCCACTA 3'

                 or M+29.1FC    5' AGCCAAGATTGAGCCACTG 3'

                 or M+30.1FG    5' CCAACCTGGGATGACAAC 3'

                 or M+30.1FC    5' CCAACCTGGGATGACAAG 3'

                 or M+30.2FC2   5' GAGCCACAGGGCAACG 3'

                 or M+30.2FT2   5' GAGCCACAGGGCAACA 3'

 

 

PCR cycling:

1 cycle of 96° 1 min

7 cycles of 96° 20 sec, 66° 14 min

11 cycles of 96° 20 sec, 65° 14 min

12 cycles of 96° 20 sec, 64° 14 min

 

 

3° PCR:

Primers:

                    M+20.0R     5' GTGTCAAGTTGAGAGACAATGG 3'

                 or M+20.1R     5' TGGGACTTCAGGCACGAGCC 3'

                 or M+20.7RA    5' CTCCCAAGCTTTCAGCACA 3'

                 or M+20.8RT    5' TTCAGCACGAGCTCTCCTT 3'

                 or M+20.9RT    5' GTGTACAATTCAGTGGGGT 3'

                 or M+20.9RC    5' GTGTACAATTCAGTGGGGC 3'

                 or M+21.3R     5' TATCTCCTCCCCAGGTTTCC 3'

together with       M+28.9F2    5' CAGGAAGAGATGGTCTCCAGC 3'

                 or M+29.5F     5' GGAGCACATAGACCTCGCC 3'

 

PCR cycling:

1 cycle of 96° 1 min

24 cycles of 96° 20 sec, 64° 10 min

 

Hotspot MSTM2

 

1° PCR:

SNPs:

    M+27.5G/C (27,563 bp) and M+35.7C/T (35,664 bp)

 

ASPs:

                    M+27.5RG    5' ATCTGCCAGAGATTCCACG 3'

                 or M+27.5RC    5' ATCTGCCAGAGATTCCACC 3'

together with       M+35.7FC    5' CTACCCTGCCTCTATACTG 3'

                 or M+35.7FT    5' CCTACCCTGCCTCTATACTA 3'

 

PCR cycling:

 

using M+27.5RG:

1 cycle of 96° 1.5 min

5 cycles of 96° 20 sec, 65° 10 min

20 cycles of 96° 20 sec, 64° 10 min

 

using M+27.5RC:

1 cycle of 96° 1.5 min

4 cycles of 96° 20 sec, 64° 10 min

6 cycles of 96° 20 sec, 63° 30 sec, 64° 10 min

15 cycles of 96° 20 sec, 62° 30 sec, 64° 10 min

 

 

2° PCR:

SNPs:

    M+28.2-/+ (28,245 bp) OR M+30.2C/T (30,164 bp)

    AND M+35.3A/G (35,291 bp)

 

ASPs:

                    M+28.2R-    5' CCTCTAGTCTGATGTAGGC 3'

                 or M+30.2RT    5' ACTGGGCTTTTTGGGCCAT 3'

together with       M+35.3FA    5' gggGTATTTCCCTGGGAAGGAAT 3'

                 or M+35.3FG    5' gggGTATTTCCCTGGGAAGGAAC 3'

 

PCR cycling:

1 cycle of 96° 1 min

3 cycles of 96° 20 sec, 66° 9.5 min

6 cycles of 96° 20 sec, 65° 9.5 min

24 cycles of 96° 20 sec, 64° 9.5 min

 

 

3° PCR:

Primers:

                    M+28.9R     5' CTACCGTGTAACACCCATCC 3'

                 or M+30.3R     5' GTCCCTAACCCTGAGCTTCC 3'

together with       M+35.1F     5' CAACTAAGGAGTGCAGGCCC 3'

 

PCR cycling:

1 cycle of 96° 1 min

26 cycles of 96° 20 sec, 61° sec, 64° 8 min

 

 

[University Home] [Faculty of Medicine and Biological Sciences Home] [Department of Genetics Home] [Staff member home page] [University Index A-Z][University Search][University Help]
Last updated: 8 September, 2005
Celia A. May
The views expressed in this document are those of the document owner, Alec J. Jeffreys.