Assaying sperm crossover hotspots in the Class II region of the MHC

Two hotspot clusters have been discovered, one around HLA-DNA and the second in and 3' to HLA-DMB. Each hotspot is assayed in sperm DNA by first digesting DNA with an appropriate restriction enzyme that cleaves outside the test interval, then PCR amplifying aliquots of digested DNA with two allele-specific primers in repulsion phase directed to SNP sites that are heterozygous in the semen donor to selectively amplify recombinant molecules. PCR products from this 1° PCR are then digested with S1 nuclease and reamplified using repulsion phase allele-specific primers directed to two internal heterozygous SNP sites to increase the specificity of single molecule recombinant recovery. 2° PCR reactions showing a recombinant are then re-amplified using two internal universal primers, though in several cases the 3° PCR included an allele-specific primer to improve the specificity of crossover recovery. Crossover breakpoints in 3° PCR products are then mapped by dotblot hybridisation with ASOs

Details of restriction enzymes, SNPs and their locations relative to the start of the 216 kb Class II region studied, plus allele-primers (ASPs) and universal primers together with PCR cycling conditions for each hotspot region are given below. Some allele-specific primers include a synthetic 5' extension indicated in blue lower case; these extension were added to improve PCR efficiency.

 

To download a pdf version of this page, click here.

HLA-DNA hotspot 1

Restriction enzyme: BglII

1° PCR:

 

SNPs: DD17T/C (19120 bp) and F8G/A (25717 bp)

ASPs:
                 DD17FAC/Dr   5' gacgtagtcgagctggtaggCTTTATTCAAAAGTACTGGC 3'

              or DD17FGT/Dr   5' gacgtagtcgagctggtaggCTTTATTCAAAAGTGCTGGT 3'

              plus     Driv   5' gacgtagtcgagctggtagg 3'

NB these allele-specific primers also incorporate SNP site DD16G/A.


together with          F8RG   5' TCCCCATGAGCCTGTCC 3'

                    or F8RA   5' TCCCCATGAGCCTGTCT 3'

PCR cycling:

1 cycle of 96° 1 min
8 cycles of 96° 20 sec, 54° 45 sec, 63° 8 min
18 cycles of 96° 20 sec, 53° 45 sec, 63° 8 min


2° PCR:

SNPs: DD18T/C (19193 bp) and F7A/G (25530 bp)

ASPs:
                    DD18FGT   5' ccccATTCCCACATCTGAAAGGTT

                 or DD18FGC   5' ccccATTCCCACATCTGAAAGGTC

NB these allele-specific primers incorporate the G allele of SNP DD24G/T.


together with         F7R2A   5' GTGGGCCCCAGGAT 3'

                   or F7R2G   5' GTGGGCCCCAGGAC 3'


PCR cycling:

1 cycle of 96° 1 min
5 cycles of 96° 20 sec, 64° 8 min
7 cycles of 96° 20 sec, 63° 8 min
16 cycles of 96° 20 sec, 61° 30 sec, 63° 8 min


3° PCR:

Primers:
                      R-5.0F   5' CCAGTCAGAGGGAAGATGGAGAAGG 3'

together with        F5RA/Pu   5' acgaccaactcgagacagcgTAGAGCAAGAATGTGTGTT 3'

                  or F5RC/Pu   5' acgaccaactcgagacagcgTAGAGCAAGAATGTGTGTG 3'

               plus     Push   5' acgaccaactcgagacagcg 3'


PCR cycling:

1 cycle of 96° 1 min
6 cycles of 96° 20 sec, 59° 30 sec, 63° 8 min
6 cycles of 96° 20 sec, 58° 30 sec, 63° 8 min
12 cycles of 96° 20 sec, 56° 30 sec, 63° 8 min

HLA-DNA hotspot 2

Restriction enzyme: SapI

1° PCR:

SNPs: DE24C/T (24287 bp) and A12C/G (32055 bp)

ASPs:
                      DE24FC   5' CTCCTCTCCCTCTGTTTC 3'

                   or DE24FT   5' CTCCTCTCCCTCTGTTTT 3'


together with       A12RC/Ad   5' gtctacgtagtcagctctGGTGACTACATTTTGTTTTAG 3'

                 or A12RG/Ad   5' gtctacgtagtcagctctGGTGACTACATTTTGTTTTAC 3'

               plus     Adap   5' gtctacgtagtcagctctgg 3'

PCR cycling:

1 cycle of 96° 1 min
7 cycles of 96° 20 sec, 57° 45 sec, 63° 8 min
7 cycles of 96° 20 sec, 56° 45 sec, 63° 8 min
11 cycles of 96° 20 sec, 55° 45 sec, 63° 8 min

2° PCR:

SNPs: F1C/T (24416 bp) and A7C/G (31882 bp)

ASPs:

                       F1FC   5' CCTGTGGACTCAGGGCCC 3'

                    or F1FT   5' CCTGTGGACTCAGGGCCT 3'


together with          A7RC   5' CTAGGGAGGAGGCAGCAG 3'

                    or A7RG   5' CTAGGGAGGAGGCAGCAC 3'



PCR cycling:

1 cycle of 96° 1 min
7 cycles of 96° 20 sec, 65° 8 min
11 cycles of 96° 20 sec, 64° 8 min
9 cycles of 96° 20 sec, 63° 8 min

3° PCR:

Primers:

                      R0.5F   5' CACCAGATGCCATGGAGACC 3'

together with          A6R+   5' CCAGTGGACGGAAGTGCC 3'

                    or A6R-   5' CCAGTGGACGGAAGTGCG 3'


PCR cycling:

1 cycle of 96° 1 min
4 cycles of 96° 20 sec, 65° 8 min
4 cycles of 96° 20 sec, 64° 8 min
14 cycles of 96° 20 sec, 63° 8 min

 

Additional allele-specific primers
that can be used for crossover recovery:

F1FT2                         5' TGTGGACTCAGGGCCT 3'

F11FC                         5' CTCATGGGTTTGTGACAGC 3'

F11FA                         5' CTCATGGGTTTGTGACAGA 3'

F5FA                          5' CCCTTCCCATTCAACACAA 3'

F5FC                          5' CCCTTCCCATTCAACACAC 3'

GA8RC                         5' AGTGGCCTGTGGGTCTG 3'

GA11RG                        5' GTCTCACAAGCTGGTCTCC 3'

GA11RA                        5' GTCTCACAAGCTGGTCTCT 3'

HLA-DNA hotspot 3

Restriction enzyme: SphI

1° PCR:

SNPs: A6+/- (31858 bp) and BC4C/T (38149 bp)

ASPs:

                        A6F+   5' AGGTGGACTCCCCGGCAC 3'

                   or   A6F-   5' AGGTGGACTCCCCGCACT 3'


together with          BC4RC   5' GAGGAAAGCTGGGGGTAG 3'

                   or  BC4RT   5' GAGGAAAGCTGGGGGTAA 3'


PCR cycling:

1 cycle of 96° 1 min
5 cycles of 96° 20 sec, 60° 30 sec, 61° 6 min
10 cycles of 96° 20 sec, 59° 30 sec, 61° 6 min
11 cycles of 96° 20 sec, 58° 30 sec, 61° 6 min


2° PCR:

SNPs: A7C/G (31882 bp) and B7T/G (37366 bp)

ASPs:

                        A7FC   5' CGTCCACTGGAAACGTTC 3'

                    or  A7FG   5' CGTCCACTGGAAACGTTG 3'


together with        B7RT/Ad   5' gtctacgtagtcagctctgGAAATGGTCAAATTTTATGTA 3'

                 or  B7RG/Ad   5' gtctacgtagtcagctctgGAAATGGTCAAATTTTATGTC 3'      6/21

                  plus  Adap   5' gtctacgtagtcagctctgg 3'



PCR cycling:

1 cycle of 96° 1 min
5 cycles of 96° 20 sec, 60° 30 sec, 61° 6 min
10 cycles of 96° 20 sec, 59° 30 sec, 61° 6 min
12 cycles of 96° 20 sec, 58° 30 sec, 61° 6 min


3° PCR:

Primers:

                      R7.6F   5' CTTGAGACCTGGTCAGGTTC 3'

together with        R13.0R   5' ggggTAATAGCCATGTAGTGGAAC 3'


PCR cycling:

1 cycle of 96° 1 min
17 cycles of 96° 20 sec, 57° 30 sec, 61° 6 min

HLA-DMB hotspots 1,2

NB these are simultaneously analysed in one test interval.

Restriction enzyme: XmnI

1° PCR:

SNPs: JJ6T/C (95104 bp) and J7C/T (100629 bp)

ASPs:
                      JJ6FT2   5' GCTCTGGTGGTGTGGT  3'

                   or  JJ6FC   5' CTGCTCTGGTGGTGTGGC 3'


together with           J7RC   5' GCCTAAGAGCAGAGGGAG 3'

                   or   J7RT   5' GCCTAAGAGCAGAGGGAA 3'


PCR cycling:

1 cycle of 96° 1 min
23 cycles of 96° 20 sec, 65° 8 min


2° PCR:

SNPs: JJ7A/C (95164 bp) and J6G/A (100470 bp)

ASPs:
                      JJ7FA1   5' ccccCTTGCTTTGAAATGAGGA 3'

                   or JJ7FC2   5' ccccCTTGCTTTGAAATGAGGC 3'


together with           J6RG   5' ATAACCCCTTCTGTCCCC 3'

                     or J6RA   5' ATAACCCCTTCTGTCCCT 3'


PCR cycling:

1 cycle of 96° 1 min
8 cycles of 96° 20 sec, 66° 8 min
18 cycles of 96° 20 sec, 65° 8 min

3° PCR:

Primers:

                     RU71.1F   5' CGGCTGGCAGACCATTTGGCATGC 3'

together with        RU76.0R   5' CTTTATTCCCTGCCCCAGACCAGC 3'


PCR cycling:

1 cycle of 96° 1 min
24 cycles of 96° 20 sec, 60° 30 sec, 63° 8 min

[University Home] [Faculty of Medicine and Biological Sciences Home] [Department of Genetics Home] [Staff member home page] [University Index A-Z][University Search][University Help]
Last updated: 8 September, 2005
Celia A. May
The views expressed in this document are those of the document owner, Alec J. Jeffreys.